The NRP1 migraine risk variant shows evidence of association with menstrual migraine

DOI: https://doi.org/10.1186/s10194- 018- 0857- z

Abstract-Summary While sub-type analysis for migraine without aura (MO) and migraine with aura (MA) found some loci showed specificity to MO, the study did not test the loci with respect to other subtypes of migraine.

This study aimed to test the hypothesis that single nucleotide polymorphisms (SNPs) robustly associated with migraine are individually or collectively associated with menstrual migraine (MM).

Genotyping of migraine susceptibility SNPs was conducted using the Agena MassARRAY platform on DNA samples from 235 women diagnosed with men- strual migraine as per International Classification for Headache Disorders II (ICHD-II) criteria and 140 controls.

Genotypes of 34 SNPs were obtained and investigated for their potential associa-

tion with menstrual migraine.

Of these SNPs, rs2506142 located near the neuropilin 1 gene (NRP1), was found

to be significantly associated with menstrual migraine (p = 0.003).

It also suggests some genetic commonality between common migraine subtypes

(MA and MO) and MM.

The identification of associated SNPs may be the starting point to a better under- standing of how genetic factors may contribute to the menstrual migraine sub-type.

Background The International Classification for Headache Disorders 3 (ICHD-3), from the International Headache Society, classifies migraine into two main subtypes: migraine without aura (MO) and migraine with aura (MA).

In population- and clinic-based studies, between 20% and 60% of women with

migraine report an association with menstruation [81].

As per the ICHD-3 classification, MM is a sub-classification of MO, as men-

struation does not appear to be associated with MA.

In 2016, Gormley and others performed a meta-analysis of 375,000 individuals from 22 genome-wide association (GWA) studies and were able to identify 46 single- nucleotide polymorphisms (SNPs) significantly associated with migraine risk, which implicated 38 genomic loci [58].

No further analysis of other migraine subtypes, including MM, was conducted.

236

2 Mechanisms

Using a case-control cohort in which the cases were specifically diagnosed with MM, this study aimed to test the hypothesis that SNPs robustly associated with migraine, as determined by Gormley and others (2016), are also individually or col- lectively associated with MM.

Methods Particular study DNA samples for 235 MM females and 140 controls were available for genotyping.

The software was used to design forward, reverse and extension primers for the

SNPs to be assayed (sequences available on request).

SpectroTYPER software was used to automatically import and analyze the geno- typing data with genotypes called based on the calculated mass of the extension products.

The primers 5’ TTTGGCCTCAGACCCCTTTA

(biotinylated) and 5’ CATCAATGGATATAGCCCACATAA were used to amplify an 83 bp biotinylated PCR product and genotyping was performed on a QSeq pyrosequencer (Bio Molecular Systems).

Sanger sequencing was used to validate genotype data for a subset of the SNPs (rs1024905, rs4910165, rs2506142), as minor allele frequencies deviated from that reported in databases.

Statistical analysis was performed on a final set of 34 SNPs using PLINK

V1.07 [82].

Case-Control association of SNPs to MM were analyzed in PLINK using

the --assoc command.

Results One of the 34 SNPs analyzed, rs1024905 (near FGF6), had a MAF that differed substantially from that annotated in databases and Gormley and others (2016), and in some samples Sanger sequencing failed to confirm genotypes obtained from the MassARRAY assay (rs4910165).

This resulted in statistical analysis being performed with 228 case samples, 131

control samples and 34 SNPs.

In order to determine any commonality in the genetic basis of MM to that of MA/ MO as identified by Gormley and others [58], we undertook GRS analysis of our 34 genotyped SNPs to investigate if they would show a signal not apparent at an indi- vidual SNP level.

As the composite association of all genotyped SNPs proved to be quite small, GRS analysis was also conducted using the subset of SNPs that were or approach- ing a nominally significant value (p < 0.1), which comprised of rs2506142, rs11624776, rs6724624, rs1925950, rs6693567, rs6791480 and rs111172113.

Discussion A small number of GWA studies have been performed attempting to identify SNPs associated with the MO and MA subtypes [66], or within an isolated population [83], but at time of writing, there have been no GWA studies specifically ana- lyzing MM.

2.1 Genetics

237

We tested the association of previously identified migraine-related SNPs in a specific MM cohort and found evidence for a potential role of rs2506142  in the Neuropilin-1 (NRP1) gene at 10p11.22 (OMIM: 602069).

There is limited research regarding the expression of NRP1 specifically during menstruation but an increase in activity has been shown during the proliferative phase of endometrial remodeling [84], which correlates with the drop in estrogen that is also believed to trigger MM.

Given the increase in activity of NRP1 during menstruation, it might be that this marker is more predictive of menstrual migraine occurring during menstruation in association with endometrial prostaglandin release rather than estrogen ‘with- drawal’ [81].

Conclusion Calculation of a GRS score for the genotyped migraine susceptibility SNPs in the MM cohort indicates some genetic commonality between migraine (MA and MO) and MM, but is not diagnostically useful.

Acknowledgement A machine generated summary based on the work of Pollock, Charmaine E.; Sutherland, Heidi G.; Maher, Bridget H.; Lea, Rodney A.; Haupt, Larisa M.; Frith, Alison; Anne MacGregor, E.; Griffiths, Lyn R. 2018 in The Journal of Headache and Pain.

New and sex-specific migraine susceptibility loci identified from a multiethnic genome-wide meta-analysis